Review



pegfp c2 cyfip1 mouse  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    OriGene pegfp c2 cyfip1 mouse
    The WRC is expressed in spinal cord commissural neurons (A) The mean mRNA expression levels (±SEM) of the WRC components in dissociated rat commissural neurons ( n = 3 independent experiments) from RNA sequencing of dissociated cultured embryonic rat commissural neurons ( GSE268644 ; from Makihara et al. ). The expression level of Boc is included for comparison. (B) Immunostaining of dissociated E13.5 rat commissural neurons for Cyfip2, <t>Cyfip1/2,</t> Abi1, and Nckap1. Two examples are shown for each antibody. F-actin was labeled with phalloidin. Cyan arrowheads indicate Cyfip2, Cyfip1/2, Abi1, or Nckap1 at the leading edge of the growth cone. Scale bar: 10 μm. (C) Schematic representation of the trajectories of commissural axons in a spinal cord cross-section of E11.5 mouse. Commissural neurons located in the dorsal spinal cord project axons that are guided ventrally toward the floor plate. Immunostaining of Cyfip1/2, Abi1, or Nckap1 with the commissural neuron marker Robo3 in E11.5 mouse spinal cord sections. (Upper row) Yellow arrows delimitate the commissural axon tract. Yellow arrowhead indicates the floor plate. Scale bar: 200 μm. (Lower row) A zoom in of the ventral spinal cord is below each corresponding image. Cyan arrowheads indicate some commissural axons. Scale bar: 100 μm. See also <xref ref-type=Figures S4–S7 . " width="250" height="auto" />
    Pegfp C2 Cyfip1 Mouse, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/SOX10+(BC002824)+Human+Untagged+Clone/pmc11617374-427-33-60
    Average 90 stars, based on 3 article reviews
    pegfp c2 cyfip1 mouse - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "The WAVE regulatory complex interacts with Boc and is required for Shh-mediated axon guidance"

    Article Title: The WAVE regulatory complex interacts with Boc and is required for Shh-mediated axon guidance

    Journal: iScience

    doi: 10.1016/j.isci.2024.111333

    The WRC is expressed in spinal cord commissural neurons (A) The mean mRNA expression levels (±SEM) of the WRC components in dissociated rat commissural neurons ( n = 3 independent experiments) from RNA sequencing of dissociated cultured embryonic rat commissural neurons ( GSE268644 ; from Makihara et al. ). The expression level of Boc is included for comparison. (B) Immunostaining of dissociated E13.5 rat commissural neurons for Cyfip2, Cyfip1/2, Abi1, and Nckap1. Two examples are shown for each antibody. F-actin was labeled with phalloidin. Cyan arrowheads indicate Cyfip2, Cyfip1/2, Abi1, or Nckap1 at the leading edge of the growth cone. Scale bar: 10 μm. (C) Schematic representation of the trajectories of commissural axons in a spinal cord cross-section of E11.5 mouse. Commissural neurons located in the dorsal spinal cord project axons that are guided ventrally toward the floor plate. Immunostaining of Cyfip1/2, Abi1, or Nckap1 with the commissural neuron marker Robo3 in E11.5 mouse spinal cord sections. (Upper row) Yellow arrows delimitate the commissural axon tract. Yellow arrowhead indicates the floor plate. Scale bar: 200 μm. (Lower row) A zoom in of the ventral spinal cord is below each corresponding image. Cyan arrowheads indicate some commissural axons. Scale bar: 100 μm. See also <xref ref-type=Figures S4–S7 . " title="... of dissociated E13.5 rat commissural neurons for Cyfip2, Cyfip1/2, Abi1, and Nckap1. Two examples are shown for ..." property="contentUrl" width="100%" height="100%"/>
    Figure Legend Snippet: The WRC is expressed in spinal cord commissural neurons (A) The mean mRNA expression levels (±SEM) of the WRC components in dissociated rat commissural neurons ( n = 3 independent experiments) from RNA sequencing of dissociated cultured embryonic rat commissural neurons ( GSE268644 ; from Makihara et al. ). The expression level of Boc is included for comparison. (B) Immunostaining of dissociated E13.5 rat commissural neurons for Cyfip2, Cyfip1/2, Abi1, and Nckap1. Two examples are shown for each antibody. F-actin was labeled with phalloidin. Cyan arrowheads indicate Cyfip2, Cyfip1/2, Abi1, or Nckap1 at the leading edge of the growth cone. Scale bar: 10 μm. (C) Schematic representation of the trajectories of commissural axons in a spinal cord cross-section of E11.5 mouse. Commissural neurons located in the dorsal spinal cord project axons that are guided ventrally toward the floor plate. Immunostaining of Cyfip1/2, Abi1, or Nckap1 with the commissural neuron marker Robo3 in E11.5 mouse spinal cord sections. (Upper row) Yellow arrows delimitate the commissural axon tract. Yellow arrowhead indicates the floor plate. Scale bar: 200 μm. (Lower row) A zoom in of the ventral spinal cord is below each corresponding image. Cyan arrowheads indicate some commissural axons. Scale bar: 100 μm. See also Figures S4–S7 .

    Techniques Used: Expressing, RNA Sequencing Assay, Cell Culture, Comparison, Immunostaining, Labeling, Marker

    Cyfip2 colocalizes with and interacts with Boc in spinal cord commissural neurons (A) Co-immunostaining of Boc with Cyfip2 or Cyfip1/2 in commissural neuron growth cones. Scale bar: 10 μm. Cyan arrows indicate colocalization between Boc and Cyfip2 or Boc and Cyfip1/2. (B) Lysates from spinal cord commissural neurons were immunoprecipitated with an anti-Boc antibody or IgG. Co-immunoprecipitated proteins were analyzed through SDS-PAGE and western blot. Endogenous Cyfip2 co-immunoprecipitates with Boc. See also <xref ref-type=Figures S4–S8 . " title="... neurons (A) Co-immunostaining of Boc with Cyfip2 or Cyfip1/2 in commissural neuron growth cones. Scale bar: 10 ..." property="contentUrl" width="100%" height="100%"/>
    Figure Legend Snippet: Cyfip2 colocalizes with and interacts with Boc in spinal cord commissural neurons (A) Co-immunostaining of Boc with Cyfip2 or Cyfip1/2 in commissural neuron growth cones. Scale bar: 10 μm. Cyan arrows indicate colocalization between Boc and Cyfip2 or Boc and Cyfip1/2. (B) Lysates from spinal cord commissural neurons were immunoprecipitated with an anti-Boc antibody or IgG. Co-immunoprecipitated proteins were analyzed through SDS-PAGE and western blot. Endogenous Cyfip2 co-immunoprecipitates with Boc. See also Figures S4–S8 .

    Techniques Used: Immunostaining, Immunoprecipitation, SDS Page, Western Blot

    Nckap1 and Cyfip1/2 are required for Shh-mediated growth cone turning (A) Dunn chamber schematic from top (left) and side (right) views from Yam et al. 2009. The inner well is filled with media containing no chemoattractant, whereas the outer well is filled with media containing chemoattractant. Diffusion of the chemoattractant from the outer well to the inner well forms a gradient of the chemoattractant over the bridge region. The neurons cultured on a coverslip and exposed to the gradient in the bridge region are imaged. (B and G) Time-lapse imaging of commissural neurons electroporated either with scrambled shRNA or shRNA targeting Nckap1 or Cyfip1/2 and exposed to a Shh gradient in a Dunn chamber. Axons of commissural neurons electroporated with scrambled shRNA turned toward high concentrations of Shh, whereas axons of Nckap1 or Cyfip1/2 knockdown neurons did not change their direction of growth. The Shh gradient increases along the y axis in the images. Scale bar: 20 μm. (C) Scatterplots of the angle turned versus the original angle between the axons and the direction of the Shh gradient for neurons under the indicated conditions. Positive angles represent turning of axons toward the Shh gradient. (D) The mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient. Nckap1 knockdown inhibits the turning of axons up a Shh gradient. Welch’s t test. n = 100 and n = 134 axons for scrambled and Nckap1 shRNA electroporated commissural neurons, respectively. (E) Scatterplots of the angle turned vs. the original angle and (F) the mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient under the indicated conditions. Expression of NCKAP1 sm -Flag rescues the inhibitory effect of Nckap1 knockdown on the turning of axons up a Shh gradient. One-way ANOVA, n = 84, n = 46, and n = 45 axons for scrambled shRNA + empty vector, Nckap1 shRNA + empty vector, and Nckap1 shRNA + NCKAP1 sm -Flag electroporated commissural neurons, respectively. (H) Scatterplots of the angle turned vs. the original angle and (I) the mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient under the indicated conditions. Cyfip1/2 knockdown inhibits the turning of axons up a Shh gradient. Unpaired t test, n = 114 and n = 101 axons for scrambled and Cyfip1/2 shRNA electroporated commissural neurons, respectively. (J) Net extension (±SEM) of the axons during the 2 h exposure to a Shh gradient. Mann-Whitney test, n = 100 and n = 134 axons for scrambled and Nckap1 shRNA electroporated commissural neurons, respectively. Kruskal-Wallis test, n = 84, n = 46, and n = 45 axons for scrambled shRNA + empty vector, Nckap1 shRNA + empty vector, and Nckap1 shRNA + NCKAP1 sm -Flag electroporated commissural neurons, respectively. Mann-Whitney test, n = 114 and n = 101 axons for scrambled and Cyfip1/2 shRNA electroporated commissural neurons, respectively. Error bars represent SEM. ∗ p < 0.05, ∗∗ p < 0.01; n.s., not significant. See also <xref ref-type=Figures S9–S11 . " title="Nckap1 and Cyfip1/2 are required for Shh-mediated growth cone turning (A) ..." property="contentUrl" width="100%" height="100%"/>
    Figure Legend Snippet: Nckap1 and Cyfip1/2 are required for Shh-mediated growth cone turning (A) Dunn chamber schematic from top (left) and side (right) views from Yam et al. 2009. The inner well is filled with media containing no chemoattractant, whereas the outer well is filled with media containing chemoattractant. Diffusion of the chemoattractant from the outer well to the inner well forms a gradient of the chemoattractant over the bridge region. The neurons cultured on a coverslip and exposed to the gradient in the bridge region are imaged. (B and G) Time-lapse imaging of commissural neurons electroporated either with scrambled shRNA or shRNA targeting Nckap1 or Cyfip1/2 and exposed to a Shh gradient in a Dunn chamber. Axons of commissural neurons electroporated with scrambled shRNA turned toward high concentrations of Shh, whereas axons of Nckap1 or Cyfip1/2 knockdown neurons did not change their direction of growth. The Shh gradient increases along the y axis in the images. Scale bar: 20 μm. (C) Scatterplots of the angle turned versus the original angle between the axons and the direction of the Shh gradient for neurons under the indicated conditions. Positive angles represent turning of axons toward the Shh gradient. (D) The mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient. Nckap1 knockdown inhibits the turning of axons up a Shh gradient. Welch’s t test. n = 100 and n = 134 axons for scrambled and Nckap1 shRNA electroporated commissural neurons, respectively. (E) Scatterplots of the angle turned vs. the original angle and (F) the mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient under the indicated conditions. Expression of NCKAP1 sm -Flag rescues the inhibitory effect of Nckap1 knockdown on the turning of axons up a Shh gradient. One-way ANOVA, n = 84, n = 46, and n = 45 axons for scrambled shRNA + empty vector, Nckap1 shRNA + empty vector, and Nckap1 shRNA + NCKAP1 sm -Flag electroporated commissural neurons, respectively. (H) Scatterplots of the angle turned vs. the original angle and (I) the mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient under the indicated conditions. Cyfip1/2 knockdown inhibits the turning of axons up a Shh gradient. Unpaired t test, n = 114 and n = 101 axons for scrambled and Cyfip1/2 shRNA electroporated commissural neurons, respectively. (J) Net extension (±SEM) of the axons during the 2 h exposure to a Shh gradient. Mann-Whitney test, n = 100 and n = 134 axons for scrambled and Nckap1 shRNA electroporated commissural neurons, respectively. Kruskal-Wallis test, n = 84, n = 46, and n = 45 axons for scrambled shRNA + empty vector, Nckap1 shRNA + empty vector, and Nckap1 shRNA + NCKAP1 sm -Flag electroporated commissural neurons, respectively. Mann-Whitney test, n = 114 and n = 101 axons for scrambled and Cyfip1/2 shRNA electroporated commissural neurons, respectively. Error bars represent SEM. ∗ p < 0.05, ∗∗ p < 0.01; n.s., not significant. See also Figures S9–S11 .

    Techniques Used: Diffusion-based Assay, Cell Culture, Imaging, shRNA, Knockdown, Expressing, Plasmid Preparation, MANN-WHITNEY


    Figure Legend Snippet:

    Techniques Used: Virus, Recombinant, Activity Assay, Protease Inhibitor, Molecular Weight, Concentration Assay, Sequencing, Modification, Affinity Purification, Expressing, shRNA, Generated, Plasmid Preparation, Software, Blocking Assay

    Related Articles

    Mutagenesis:

    Article Title: Cyfip1 Regulates Presynaptic Activity during Development
    Article Snippet: FM4-64 lipophilic dye (Invitrogen), bafilomycin A1(1 μ m , Tocris Bioscience), CNQX (50 μ m , Tocris Bioscience), APV (25 μ m , Tocris Bioscience), MK-801 (40 μ m , Tocris Bioscience), NSC23766 (200 μ m , Tocris Bioscience), ADVASEP-7 (0.5 m m , Sigma), and rhodamine phalloidin (Invitrogen). shCyfip1 is a validated hairpin sequence recognizing both mouse and rat Cyfip1 ( Silva et al., 2009 ) (Dharmacon RNAi: V2LMM_79585, mature antisense: TACATAAAGACAAACATGC); shCyfip1–2 (ttgaaagtgaagatttaacatca; {"type":"entrez-nucleotide","attrs":{"text":"NM_001107517","term_id":"157822936","term_text":"NM_001107517"}} NM_001107517 ) targets rat Cyfip1 (QIAGEN SureSilence: KR45495G). shCyfip1 was used unless otherwise noted; nonsilencing shRNA construct shCon (Dharmacon, RHS4346). .. Human Cyfip1 (hCyfip1), Cyfip1 K743E missense mutation (mutE), and Cyfip1 C terminus truncation (δC/ΔC) expression constructs used in the rescue experiments were generated using CYFIP1TrueORF expression-validated vectors purchased from OriGene (GenBank ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_014608","term_id":"1190332459","term_text":"NM_014608"}} NM_014608 , OriGENE SKU: RC203015), with the respective nucleotide sequences replaced as described in the text and A . pcDNA3-SypHluorin 2x (SypH) was kindly provided by Yongling Zhu (Salk Institute) ( Zhu and Stevens, 2008 ). fig ft0 fig mode=article f1 Figure 6. caption a4 Cyfip1-WAVE1 interaction regulates presynaptic function. ..

    Expressing:

    Article Title: Cyfip1 Regulates Presynaptic Activity during Development
    Article Snippet: FM4-64 lipophilic dye (Invitrogen), bafilomycin A1(1 μ m , Tocris Bioscience), CNQX (50 μ m , Tocris Bioscience), APV (25 μ m , Tocris Bioscience), MK-801 (40 μ m , Tocris Bioscience), NSC23766 (200 μ m , Tocris Bioscience), ADVASEP-7 (0.5 m m , Sigma), and rhodamine phalloidin (Invitrogen). shCyfip1 is a validated hairpin sequence recognizing both mouse and rat Cyfip1 ( Silva et al., 2009 ) (Dharmacon RNAi: V2LMM_79585, mature antisense: TACATAAAGACAAACATGC); shCyfip1–2 (ttgaaagtgaagatttaacatca; {"type":"entrez-nucleotide","attrs":{"text":"NM_001107517","term_id":"157822936","term_text":"NM_001107517"}} NM_001107517 ) targets rat Cyfip1 (QIAGEN SureSilence: KR45495G). shCyfip1 was used unless otherwise noted; nonsilencing shRNA construct shCon (Dharmacon, RHS4346). .. Human Cyfip1 (hCyfip1), Cyfip1 K743E missense mutation (mutE), and Cyfip1 C terminus truncation (δC/ΔC) expression constructs used in the rescue experiments were generated using CYFIP1TrueORF expression-validated vectors purchased from OriGene (GenBank ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_014608","term_id":"1190332459","term_text":"NM_014608"}} NM_014608 , OriGENE SKU: RC203015), with the respective nucleotide sequences replaced as described in the text and A . pcDNA3-SypHluorin 2x (SypH) was kindly provided by Yongling Zhu (Salk Institute) ( Zhu and Stevens, 2008 ). fig ft0 fig mode=article f1 Figure 6. caption a4 Cyfip1-WAVE1 interaction regulates presynaptic function. ..

    Construct:

    Article Title: Cyfip1 Regulates Presynaptic Activity during Development
    Article Snippet: FM4-64 lipophilic dye (Invitrogen), bafilomycin A1(1 μ m , Tocris Bioscience), CNQX (50 μ m , Tocris Bioscience), APV (25 μ m , Tocris Bioscience), MK-801 (40 μ m , Tocris Bioscience), NSC23766 (200 μ m , Tocris Bioscience), ADVASEP-7 (0.5 m m , Sigma), and rhodamine phalloidin (Invitrogen). shCyfip1 is a validated hairpin sequence recognizing both mouse and rat Cyfip1 ( Silva et al., 2009 ) (Dharmacon RNAi: V2LMM_79585, mature antisense: TACATAAAGACAAACATGC); shCyfip1–2 (ttgaaagtgaagatttaacatca; {"type":"entrez-nucleotide","attrs":{"text":"NM_001107517","term_id":"157822936","term_text":"NM_001107517"}} NM_001107517 ) targets rat Cyfip1 (QIAGEN SureSilence: KR45495G). shCyfip1 was used unless otherwise noted; nonsilencing shRNA construct shCon (Dharmacon, RHS4346). .. Human Cyfip1 (hCyfip1), Cyfip1 K743E missense mutation (mutE), and Cyfip1 C terminus truncation (δC/ΔC) expression constructs used in the rescue experiments were generated using CYFIP1TrueORF expression-validated vectors purchased from OriGene (GenBank ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_014608","term_id":"1190332459","term_text":"NM_014608"}} NM_014608 , OriGENE SKU: RC203015), with the respective nucleotide sequences replaced as described in the text and A . pcDNA3-SypHluorin 2x (SypH) was kindly provided by Yongling Zhu (Salk Institute) ( Zhu and Stevens, 2008 ). fig ft0 fig mode=article f1 Figure 6. caption a4 Cyfip1-WAVE1 interaction regulates presynaptic function. ..

    Generated:

    Article Title: Cyfip1 Regulates Presynaptic Activity during Development
    Article Snippet: FM4-64 lipophilic dye (Invitrogen), bafilomycin A1(1 μ m , Tocris Bioscience), CNQX (50 μ m , Tocris Bioscience), APV (25 μ m , Tocris Bioscience), MK-801 (40 μ m , Tocris Bioscience), NSC23766 (200 μ m , Tocris Bioscience), ADVASEP-7 (0.5 m m , Sigma), and rhodamine phalloidin (Invitrogen). shCyfip1 is a validated hairpin sequence recognizing both mouse and rat Cyfip1 ( Silva et al., 2009 ) (Dharmacon RNAi: V2LMM_79585, mature antisense: TACATAAAGACAAACATGC); shCyfip1–2 (ttgaaagtgaagatttaacatca; {"type":"entrez-nucleotide","attrs":{"text":"NM_001107517","term_id":"157822936","term_text":"NM_001107517"}} NM_001107517 ) targets rat Cyfip1 (QIAGEN SureSilence: KR45495G). shCyfip1 was used unless otherwise noted; nonsilencing shRNA construct shCon (Dharmacon, RHS4346). .. Human Cyfip1 (hCyfip1), Cyfip1 K743E missense mutation (mutE), and Cyfip1 C terminus truncation (δC/ΔC) expression constructs used in the rescue experiments were generated using CYFIP1TrueORF expression-validated vectors purchased from OriGene (GenBank ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_014608","term_id":"1190332459","term_text":"NM_014608"}} NM_014608 , OriGENE SKU: RC203015), with the respective nucleotide sequences replaced as described in the text and A . pcDNA3-SypHluorin 2x (SypH) was kindly provided by Yongling Zhu (Salk Institute) ( Zhu and Stevens, 2008 ). fig ft0 fig mode=article f1 Figure 6. caption a4 Cyfip1-WAVE1 interaction regulates presynaptic function. ..



    Similar Products

    pegfp c2 cyfip1 mouse  (OriGene)
    90
    OriGene pegfp c2 cyfip1 mouse
    The WRC is expressed in spinal cord commissural neurons (A) The mean mRNA expression levels (±SEM) of the WRC components in dissociated rat commissural neurons ( n = 3 independent experiments) from RNA sequencing of dissociated cultured embryonic rat commissural neurons ( GSE268644 ; from Makihara et al. ). The expression level of Boc is included for comparison. (B) Immunostaining of dissociated E13.5 rat commissural neurons for Cyfip2, <t>Cyfip1/2,</t> Abi1, and Nckap1. Two examples are shown for each antibody. F-actin was labeled with phalloidin. Cyan arrowheads indicate Cyfip2, Cyfip1/2, Abi1, or Nckap1 at the leading edge of the growth cone. Scale bar: 10 μm. (C) Schematic representation of the trajectories of commissural axons in a spinal cord cross-section of E11.5 mouse. Commissural neurons located in the dorsal spinal cord project axons that are guided ventrally toward the floor plate. Immunostaining of Cyfip1/2, Abi1, or Nckap1 with the commissural neuron marker Robo3 in E11.5 mouse spinal cord sections. (Upper row) Yellow arrows delimitate the commissural axon tract. Yellow arrowhead indicates the floor plate. Scale bar: 200 μm. (Lower row) A zoom in of the ventral spinal cord is below each corresponding image. Cyan arrowheads indicate some commissural axons. Scale bar: 100 μm. See also <xref ref-type=Figures S4–S7 . " width="250" height="auto" />
    Pegfp C2 Cyfip1 Mouse, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/SOX10+(BC002824)+Human+Untagged+Clone/pmc11617374-427-33-60
    Average 90 stars, based on 1 article reviews
    pegfp c2 cyfip1 mouse - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    paper n a recombinant dna cyfip1 orf origene  (OriGene)
    92
    OriGene paper n a recombinant dna cyfip1 orf origene
    Figure 2. <t>CYFIP1</t> dosage change affects NPC cell-cycle profile (A) Representative images of cells labeled with EdU (red) and NeuN (green) at d35. D30 cultures were incubated with EdU for 2 h and co-immunostained 5 days later for EdU and NeuN. Scale bar: 50 mm. (B and C) Quantification of EdU-retaining cells in NeuN+ neurons. Data presented are mean ± SEM from four biological replicates. Student’s t test, n = 4, *p < 0.05. (D and G) Representative histograms of a flow-cytometry-based cell-cycle analysis on d20 cultures.
    Paper N A Recombinant Dna Cyfip1 Orf Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/CYFIP1+(NM_014608)+Human+Untagged+Clone/pm38483902-598-112-118
    Average 92 stars, based on 1 article reviews
    paper n a recombinant dna cyfip1 orf origene - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    paper n a pcag cyfip1 ires pac  (OriGene)
    92
    OriGene paper n a pcag cyfip1 ires pac
    Figure 2. <t>CYFIP1</t> dosage change affects NPC cell-cycle profile (A) Representative images of cells labeled with EdU (red) and NeuN (green) at d35. D30 cultures were incubated with EdU for 2 h and co-immunostained 5 days later for EdU and NeuN. Scale bar: 50 mm. (B and C) Quantification of EdU-retaining cells in NeuN+ neurons. Data presented are mean ± SEM from four biological replicates. Student’s t test, n = 4, *p < 0.05. (D and G) Representative histograms of a flow-cytometry-based cell-cycle analysis on d20 cultures.
    Paper N A Pcag Cyfip1 Ires Pac, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/CYFIP1+(NM_014608)+Human+Untagged+Clone/pm38483902-598-123-118
    Average 92 stars, based on 1 article reviews
    paper n a pcag cyfip1 ires pac - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    human cyfip1 open reading frame  (OriGene)
    92
    OriGene human cyfip1 open reading frame
    Figure 2. <t>CYFIP1</t> dosage change affects NPC cell-cycle profile (A) Representative images of cells labeled with EdU (red) and NeuN (green) at d35. D30 cultures were incubated with EdU for 2 h and co-immunostained 5 days later for EdU and NeuN. Scale bar: 50 mm. (B and C) Quantification of EdU-retaining cells in NeuN+ neurons. Data presented are mean ± SEM from four biological replicates. Student’s t test, n = 4, *p < 0.05. (D and G) Representative histograms of a flow-cytometry-based cell-cycle analysis on d20 cultures.
    Human Cyfip1 Open Reading Frame, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/CYFIP1+(NM_014608)+Human+Untagged+Clone/pm38483902-607-5-11
    Average 92 stars, based on 1 article reviews
    human cyfip1 open reading frame - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    sc100426 pcag ires pac  (OriGene)
    92
    OriGene sc100426 pcag ires pac
    Figure 2. <t>CYFIP1</t> dosage change affects NPC cell-cycle profile (A) Representative images of cells labeled with EdU (red) and NeuN (green) at d35. D30 cultures were incubated with EdU for 2 h and co-immunostained 5 days later for EdU and NeuN. Scale bar: 50 mm. (B and C) Quantification of EdU-retaining cells in NeuN+ neurons. Data presented are mean ± SEM from four biological replicates. Student’s t test, n = 4, *p < 0.05. (D and G) Representative histograms of a flow-cytometry-based cell-cycle analysis on d20 cultures.
    Sc100426 Pcag Ires Pac, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/CYFIP1+(NM_014608)+Human+Untagged+Clone/pm38483902-598-120-118
    Average 92 stars, based on 1 article reviews
    sc100426 pcag ires pac - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    cyfip1 gof lines  (OriGene)
    92
    OriGene cyfip1 gof lines
    Figure 2. <t>CYFIP1</t> dosage change affects NPC cell-cycle profile (A) Representative images of cells labeled with EdU (red) and NeuN (green) at d35. D30 cultures were incubated with EdU for 2 h and co-immunostained 5 days later for EdU and NeuN. Scale bar: 50 mm. (B and C) Quantification of EdU-retaining cells in NeuN+ neurons. Data presented are mean ± SEM from four biological replicates. Student’s t test, n = 4, *p < 0.05. (D and G) Representative histograms of a flow-cytometry-based cell-cycle analysis on d20 cultures.
    Cyfip1 Gof Lines, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/CYFIP1+(NM_014608)+Human+Untagged+Clone/pm38483902-607-3-11
    Average 92 stars, based on 1 article reviews
    cyfip1 gof lines - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    human cyfip1 open reading frame sc100426  (OriGene)
    90
    OriGene human cyfip1 open reading frame sc100426
    A) Schematic representation of human <t>CYFIP1</t> expression vector. B) qPCR quantification of CYFIP1 transcript levels in independent transgenic CYFIP1-GoF hESCs lines (TG#1 -10) and parental H7 cells (CTRL) at undifferentiated state. Data were normalised to the CTRL which was set as 1. C) qPCR analysis of CYFIP1 transcript during neuronal differentiation. Data shown are the mean between clones #3 and #5, all normalised to the CTRL cells at d5 of neuronal differentiation. D) Western blot confirming increased CYFIP1 protein level in CYFIP1-GoF cells (Clone #3) throughout 50 days of neuronal differentiation. Quantitative data on the right panel represent the average of clones #3 and #5. E) Schematic of CYFIP1 gene locus highlighting the first exon where gRNA sequences were designed. For space reasons, the sequence of the insertion present in one of the alleles of clone#70 is not reported and is indicated as “--200bp--”. F) DNA sequence flanking the edited site in the wild-type and edited CYFIP1 locus. G) Western blot demonstrating reduced CYFIP1 protein levels in 3 of the targeted clones (CYFIP1 clone#31, clone#41 and #70) compared to the parental line (CTRL).
    Human Cyfip1 Open Reading Frame Sc100426, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/human+cyfip1+open+reading+frame+sc100426/bio_rxiv__2023__06__23__546272-235-4-10
    Average 90 stars, based on 1 article reviews
    human cyfip1 open reading frame sc100426 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    cyfip1 overexpression  (OriGene)
    92
    OriGene cyfip1 overexpression
    A) Schematic representation of human <t>CYFIP1</t> expression vector. B) qPCR quantification of CYFIP1 transcript levels in independent transgenic CYFIP1-GoF hESCs lines (TG#1 -10) and parental H7 cells (CTRL) at undifferentiated state. Data were normalised to the CTRL which was set as 1. C) qPCR analysis of CYFIP1 transcript during neuronal differentiation. Data shown are the mean between clones #3 and #5, all normalised to the CTRL cells at d5 of neuronal differentiation. D) Western blot confirming increased CYFIP1 protein level in CYFIP1-GoF cells (Clone #3) throughout 50 days of neuronal differentiation. Quantitative data on the right panel represent the average of clones #3 and #5. E) Schematic of CYFIP1 gene locus highlighting the first exon where gRNA sequences were designed. For space reasons, the sequence of the insertion present in one of the alleles of clone#70 is not reported and is indicated as “--200bp--”. F) DNA sequence flanking the edited site in the wild-type and edited CYFIP1 locus. G) Western blot demonstrating reduced CYFIP1 protein levels in 3 of the targeted clones (CYFIP1 clone#31, clone#41 and #70) compared to the parental line (CTRL).
    Cyfip1 Overexpression, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/CYFIP1+(NM_014608)+Human+Untagged+Clone/bio_rxiv__2023__06__23__546272-235-1-10
    Average 92 stars, based on 1 article reviews
    cyfip1 overexpression - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    cyfip1 mouse line  (Taconic Biosciences)
    93
    Taconic Biosciences cyfip1 mouse line
    A) Schematic representation of human <t>CYFIP1</t> expression vector. B) qPCR quantification of CYFIP1 transcript levels in independent transgenic CYFIP1-GoF hESCs lines (TG#1 -10) and parental H7 cells (CTRL) at undifferentiated state. Data were normalised to the CTRL which was set as 1. C) qPCR analysis of CYFIP1 transcript during neuronal differentiation. Data shown are the mean between clones #3 and #5, all normalised to the CTRL cells at d5 of neuronal differentiation. D) Western blot confirming increased CYFIP1 protein level in CYFIP1-GoF cells (Clone #3) throughout 50 days of neuronal differentiation. Quantitative data on the right panel represent the average of clones #3 and #5. E) Schematic of CYFIP1 gene locus highlighting the first exon where gRNA sequences were designed. For space reasons, the sequence of the insertion present in one of the alleles of clone#70 is not reported and is indicated as “--200bp--”. F) DNA sequence flanking the edited site in the wild-type and edited CYFIP1 locus. G) Western blot demonstrating reduced CYFIP1 protein levels in 3 of the targeted clones (CYFIP1 clone#31, clone#41 and #70) compared to the parental line (CTRL).
    Cyfip1 Mouse Line, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+cyfip1/10__1523_slash_eneuro__0364___18__2019-54-1-30
    Average 93 stars, based on 1 article reviews
    cyfip1 mouse line - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    The WRC is expressed in spinal cord commissural neurons (A) The mean mRNA expression levels (±SEM) of the WRC components in dissociated rat commissural neurons ( n = 3 independent experiments) from RNA sequencing of dissociated cultured embryonic rat commissural neurons ( GSE268644 ; from Makihara et al. ). The expression level of Boc is included for comparison. (B) Immunostaining of dissociated E13.5 rat commissural neurons for Cyfip2, Cyfip1/2, Abi1, and Nckap1. Two examples are shown for each antibody. F-actin was labeled with phalloidin. Cyan arrowheads indicate Cyfip2, Cyfip1/2, Abi1, or Nckap1 at the leading edge of the growth cone. Scale bar: 10 μm. (C) Schematic representation of the trajectories of commissural axons in a spinal cord cross-section of E11.5 mouse. Commissural neurons located in the dorsal spinal cord project axons that are guided ventrally toward the floor plate. Immunostaining of Cyfip1/2, Abi1, or Nckap1 with the commissural neuron marker Robo3 in E11.5 mouse spinal cord sections. (Upper row) Yellow arrows delimitate the commissural axon tract. Yellow arrowhead indicates the floor plate. Scale bar: 200 μm. (Lower row) A zoom in of the ventral spinal cord is below each corresponding image. Cyan arrowheads indicate some commissural axons. Scale bar: 100 μm. See also <xref ref-type=Figures S4–S7 . " width="100%" height="100%">

    Journal: iScience

    Article Title: The WAVE regulatory complex interacts with Boc and is required for Shh-mediated axon guidance

    doi: 10.1016/j.isci.2024.111333

    Figure Lengend Snippet: The WRC is expressed in spinal cord commissural neurons (A) The mean mRNA expression levels (±SEM) of the WRC components in dissociated rat commissural neurons ( n = 3 independent experiments) from RNA sequencing of dissociated cultured embryonic rat commissural neurons ( GSE268644 ; from Makihara et al. ). The expression level of Boc is included for comparison. (B) Immunostaining of dissociated E13.5 rat commissural neurons for Cyfip2, Cyfip1/2, Abi1, and Nckap1. Two examples are shown for each antibody. F-actin was labeled with phalloidin. Cyan arrowheads indicate Cyfip2, Cyfip1/2, Abi1, or Nckap1 at the leading edge of the growth cone. Scale bar: 10 μm. (C) Schematic representation of the trajectories of commissural axons in a spinal cord cross-section of E11.5 mouse. Commissural neurons located in the dorsal spinal cord project axons that are guided ventrally toward the floor plate. Immunostaining of Cyfip1/2, Abi1, or Nckap1 with the commissural neuron marker Robo3 in E11.5 mouse spinal cord sections. (Upper row) Yellow arrows delimitate the commissural axon tract. Yellow arrowhead indicates the floor plate. Scale bar: 200 μm. (Lower row) A zoom in of the ventral spinal cord is below each corresponding image. Cyan arrowheads indicate some commissural axons. Scale bar: 100 μm. See also Figures S4–S7 .

    Article Snippet: NAP1-Flag-WT was subcloned from pFLAG-CMV-2-NAP1 to pCAGGS (in Kpn1 at the multiple cloning site (MCS)) using In-Fusion to generate pCAGGS-NCKAP1-Flag. pcDNA3.1(+)Myc-Cyfip2 (mouse) and pCMV-Tag2B-Nap1 (Flag tagged) (mouse) were gifts from Dr. Jia-Jia Liu. pEGFP-C2-Cyfip1 (mouse) was generated by Steffen et al. pcDNA3-Human WAVE1-Flag was a gift from Dr. Greg Bashaw (generated by Westphal et al. ). pCMV6-Entry-BRK1(HSPC300)-Myc-DDK(Flag) was obtained from Origene (cat# RC200804). pCAGGS-NCKAP1 sm -Flag, the shRNA resistant form of human NCKAP1, was made by subcloning NAP1-Flag-WT from pFLAG-CMV-2-NAP1 to pCAGGS (into the Kpn1 site) to have better expression in commissural neurons, along with making silent mutations in NCKAP1, using In-Fusion Cloning Technology.

    Techniques: Expressing, RNA Sequencing Assay, Cell Culture, Comparison, Immunostaining, Labeling, Marker

    Cyfip2 colocalizes with and interacts with Boc in spinal cord commissural neurons (A) Co-immunostaining of Boc with Cyfip2 or Cyfip1/2 in commissural neuron growth cones. Scale bar: 10 μm. Cyan arrows indicate colocalization between Boc and Cyfip2 or Boc and Cyfip1/2. (B) Lysates from spinal cord commissural neurons were immunoprecipitated with an anti-Boc antibody or IgG. Co-immunoprecipitated proteins were analyzed through SDS-PAGE and western blot. Endogenous Cyfip2 co-immunoprecipitates with Boc. See also <xref ref-type=Figures S4–S8 . " width="100%" height="100%">

    Journal: iScience

    Article Title: The WAVE regulatory complex interacts with Boc and is required for Shh-mediated axon guidance

    doi: 10.1016/j.isci.2024.111333

    Figure Lengend Snippet: Cyfip2 colocalizes with and interacts with Boc in spinal cord commissural neurons (A) Co-immunostaining of Boc with Cyfip2 or Cyfip1/2 in commissural neuron growth cones. Scale bar: 10 μm. Cyan arrows indicate colocalization between Boc and Cyfip2 or Boc and Cyfip1/2. (B) Lysates from spinal cord commissural neurons were immunoprecipitated with an anti-Boc antibody or IgG. Co-immunoprecipitated proteins were analyzed through SDS-PAGE and western blot. Endogenous Cyfip2 co-immunoprecipitates with Boc. See also Figures S4–S8 .

    Article Snippet: NAP1-Flag-WT was subcloned from pFLAG-CMV-2-NAP1 to pCAGGS (in Kpn1 at the multiple cloning site (MCS)) using In-Fusion to generate pCAGGS-NCKAP1-Flag. pcDNA3.1(+)Myc-Cyfip2 (mouse) and pCMV-Tag2B-Nap1 (Flag tagged) (mouse) were gifts from Dr. Jia-Jia Liu. pEGFP-C2-Cyfip1 (mouse) was generated by Steffen et al. pcDNA3-Human WAVE1-Flag was a gift from Dr. Greg Bashaw (generated by Westphal et al. ). pCMV6-Entry-BRK1(HSPC300)-Myc-DDK(Flag) was obtained from Origene (cat# RC200804). pCAGGS-NCKAP1 sm -Flag, the shRNA resistant form of human NCKAP1, was made by subcloning NAP1-Flag-WT from pFLAG-CMV-2-NAP1 to pCAGGS (into the Kpn1 site) to have better expression in commissural neurons, along with making silent mutations in NCKAP1, using In-Fusion Cloning Technology.

    Techniques: Immunostaining, Immunoprecipitation, SDS Page, Western Blot

    Nckap1 and Cyfip1/2 are required for Shh-mediated growth cone turning (A) Dunn chamber schematic from top (left) and side (right) views from Yam et al. 2009. The inner well is filled with media containing no chemoattractant, whereas the outer well is filled with media containing chemoattractant. Diffusion of the chemoattractant from the outer well to the inner well forms a gradient of the chemoattractant over the bridge region. The neurons cultured on a coverslip and exposed to the gradient in the bridge region are imaged. (B and G) Time-lapse imaging of commissural neurons electroporated either with scrambled shRNA or shRNA targeting Nckap1 or Cyfip1/2 and exposed to a Shh gradient in a Dunn chamber. Axons of commissural neurons electroporated with scrambled shRNA turned toward high concentrations of Shh, whereas axons of Nckap1 or Cyfip1/2 knockdown neurons did not change their direction of growth. The Shh gradient increases along the y axis in the images. Scale bar: 20 μm. (C) Scatterplots of the angle turned versus the original angle between the axons and the direction of the Shh gradient for neurons under the indicated conditions. Positive angles represent turning of axons toward the Shh gradient. (D) The mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient. Nckap1 knockdown inhibits the turning of axons up a Shh gradient. Welch’s t test. n = 100 and n = 134 axons for scrambled and Nckap1 shRNA electroporated commissural neurons, respectively. (E) Scatterplots of the angle turned vs. the original angle and (F) the mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient under the indicated conditions. Expression of NCKAP1 sm -Flag rescues the inhibitory effect of Nckap1 knockdown on the turning of axons up a Shh gradient. One-way ANOVA, n = 84, n = 46, and n = 45 axons for scrambled shRNA + empty vector, Nckap1 shRNA + empty vector, and Nckap1 shRNA + NCKAP1 sm -Flag electroporated commissural neurons, respectively. (H) Scatterplots of the angle turned vs. the original angle and (I) the mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient under the indicated conditions. Cyfip1/2 knockdown inhibits the turning of axons up a Shh gradient. Unpaired t test, n = 114 and n = 101 axons for scrambled and Cyfip1/2 shRNA electroporated commissural neurons, respectively. (J) Net extension (±SEM) of the axons during the 2 h exposure to a Shh gradient. Mann-Whitney test, n = 100 and n = 134 axons for scrambled and Nckap1 shRNA electroporated commissural neurons, respectively. Kruskal-Wallis test, n = 84, n = 46, and n = 45 axons for scrambled shRNA + empty vector, Nckap1 shRNA + empty vector, and Nckap1 shRNA + NCKAP1 sm -Flag electroporated commissural neurons, respectively. Mann-Whitney test, n = 114 and n = 101 axons for scrambled and Cyfip1/2 shRNA electroporated commissural neurons, respectively. Error bars represent SEM. ∗ p < 0.05, ∗∗ p < 0.01; n.s., not significant. See also <xref ref-type=Figures S9–S11 . " width="100%" height="100%">

    Journal: iScience

    Article Title: The WAVE regulatory complex interacts with Boc and is required for Shh-mediated axon guidance

    doi: 10.1016/j.isci.2024.111333

    Figure Lengend Snippet: Nckap1 and Cyfip1/2 are required for Shh-mediated growth cone turning (A) Dunn chamber schematic from top (left) and side (right) views from Yam et al. 2009. The inner well is filled with media containing no chemoattractant, whereas the outer well is filled with media containing chemoattractant. Diffusion of the chemoattractant from the outer well to the inner well forms a gradient of the chemoattractant over the bridge region. The neurons cultured on a coverslip and exposed to the gradient in the bridge region are imaged. (B and G) Time-lapse imaging of commissural neurons electroporated either with scrambled shRNA or shRNA targeting Nckap1 or Cyfip1/2 and exposed to a Shh gradient in a Dunn chamber. Axons of commissural neurons electroporated with scrambled shRNA turned toward high concentrations of Shh, whereas axons of Nckap1 or Cyfip1/2 knockdown neurons did not change their direction of growth. The Shh gradient increases along the y axis in the images. Scale bar: 20 μm. (C) Scatterplots of the angle turned versus the original angle between the axons and the direction of the Shh gradient for neurons under the indicated conditions. Positive angles represent turning of axons toward the Shh gradient. (D) The mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient. Nckap1 knockdown inhibits the turning of axons up a Shh gradient. Welch’s t test. n = 100 and n = 134 axons for scrambled and Nckap1 shRNA electroporated commissural neurons, respectively. (E) Scatterplots of the angle turned vs. the original angle and (F) the mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient under the indicated conditions. Expression of NCKAP1 sm -Flag rescues the inhibitory effect of Nckap1 knockdown on the turning of axons up a Shh gradient. One-way ANOVA, n = 84, n = 46, and n = 45 axons for scrambled shRNA + empty vector, Nckap1 shRNA + empty vector, and Nckap1 shRNA + NCKAP1 sm -Flag electroporated commissural neurons, respectively. (H) Scatterplots of the angle turned vs. the original angle and (I) the mean angle turned (±SEM) of axons of commissural neurons in a Shh gradient under the indicated conditions. Cyfip1/2 knockdown inhibits the turning of axons up a Shh gradient. Unpaired t test, n = 114 and n = 101 axons for scrambled and Cyfip1/2 shRNA electroporated commissural neurons, respectively. (J) Net extension (±SEM) of the axons during the 2 h exposure to a Shh gradient. Mann-Whitney test, n = 100 and n = 134 axons for scrambled and Nckap1 shRNA electroporated commissural neurons, respectively. Kruskal-Wallis test, n = 84, n = 46, and n = 45 axons for scrambled shRNA + empty vector, Nckap1 shRNA + empty vector, and Nckap1 shRNA + NCKAP1 sm -Flag electroporated commissural neurons, respectively. Mann-Whitney test, n = 114 and n = 101 axons for scrambled and Cyfip1/2 shRNA electroporated commissural neurons, respectively. Error bars represent SEM. ∗ p < 0.05, ∗∗ p < 0.01; n.s., not significant. See also Figures S9–S11 .

    Article Snippet: NAP1-Flag-WT was subcloned from pFLAG-CMV-2-NAP1 to pCAGGS (in Kpn1 at the multiple cloning site (MCS)) using In-Fusion to generate pCAGGS-NCKAP1-Flag. pcDNA3.1(+)Myc-Cyfip2 (mouse) and pCMV-Tag2B-Nap1 (Flag tagged) (mouse) were gifts from Dr. Jia-Jia Liu. pEGFP-C2-Cyfip1 (mouse) was generated by Steffen et al. pcDNA3-Human WAVE1-Flag was a gift from Dr. Greg Bashaw (generated by Westphal et al. ). pCMV6-Entry-BRK1(HSPC300)-Myc-DDK(Flag) was obtained from Origene (cat# RC200804). pCAGGS-NCKAP1 sm -Flag, the shRNA resistant form of human NCKAP1, was made by subcloning NAP1-Flag-WT from pFLAG-CMV-2-NAP1 to pCAGGS (into the Kpn1 site) to have better expression in commissural neurons, along with making silent mutations in NCKAP1, using In-Fusion Cloning Technology.

    Techniques: Diffusion-based Assay, Cell Culture, Imaging, shRNA, Knockdown, Expressing, Plasmid Preparation, MANN-WHITNEY

    Journal: iScience

    Article Title: The WAVE regulatory complex interacts with Boc and is required for Shh-mediated axon guidance

    doi: 10.1016/j.isci.2024.111333

    Figure Lengend Snippet:

    Article Snippet: NAP1-Flag-WT was subcloned from pFLAG-CMV-2-NAP1 to pCAGGS (in Kpn1 at the multiple cloning site (MCS)) using In-Fusion to generate pCAGGS-NCKAP1-Flag. pcDNA3.1(+)Myc-Cyfip2 (mouse) and pCMV-Tag2B-Nap1 (Flag tagged) (mouse) were gifts from Dr. Jia-Jia Liu. pEGFP-C2-Cyfip1 (mouse) was generated by Steffen et al. pcDNA3-Human WAVE1-Flag was a gift from Dr. Greg Bashaw (generated by Westphal et al. ). pCMV6-Entry-BRK1(HSPC300)-Myc-DDK(Flag) was obtained from Origene (cat# RC200804). pCAGGS-NCKAP1 sm -Flag, the shRNA resistant form of human NCKAP1, was made by subcloning NAP1-Flag-WT from pFLAG-CMV-2-NAP1 to pCAGGS (into the Kpn1 site) to have better expression in commissural neurons, along with making silent mutations in NCKAP1, using In-Fusion Cloning Technology.

    Techniques: Virus, Recombinant, Activity Assay, Protease Inhibitor, Molecular Weight, Concentration Assay, Sequencing, Modification, Affinity Purification, Expressing, shRNA, Generated, Plasmid Preparation, Software, Blocking Assay

    Figure 2. CYFIP1 dosage change affects NPC cell-cycle profile (A) Representative images of cells labeled with EdU (red) and NeuN (green) at d35. D30 cultures were incubated with EdU for 2 h and co-immunostained 5 days later for EdU and NeuN. Scale bar: 50 mm. (B and C) Quantification of EdU-retaining cells in NeuN+ neurons. Data presented are mean ± SEM from four biological replicates. Student’s t test, n = 4, *p < 0.05. (D and G) Representative histograms of a flow-cytometry-based cell-cycle analysis on d20 cultures.

    Journal: Cell reports

    Article Title: Impaired oxysterol-liver X receptor signaling underlies aberrant cortical neurogenesis in a stem cell model of neurodevelopmental disorder.

    doi: 10.1016/j.celrep.2024.113946

    Figure Lengend Snippet: Figure 2. CYFIP1 dosage change affects NPC cell-cycle profile (A) Representative images of cells labeled with EdU (red) and NeuN (green) at d35. D30 cultures were incubated with EdU for 2 h and co-immunostained 5 days later for EdU and NeuN. Scale bar: 50 mm. (B and C) Quantification of EdU-retaining cells in NeuN+ neurons. Data presented are mean ± SEM from four biological replicates. Student’s t test, n = 4, *p < 0.05. (D and G) Representative histograms of a flow-cytometry-based cell-cycle analysis on d20 cultures.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 24R/S-hydroxycholesterol-D6 SigmaAldrich Cat # 700018P 7a-hydroxycholesterol-D7 SigmaAldrich Cat # LM-4103 7-oxocholesterol-D7 SigmaAldrich Cat # LM-4107 22S-3O-hydroxycholesterol-D7 SigmaAldrich Cat # 700051P 7a, 25-dihydroxycholsterol-D6 SigmaAldrich Cat # 700078 3b-hydroxycholest-5-en-26-oic acid-D5 SigmaAldrich Cat # 700151P 7aH,3O-hydroxycholestenoic acid-D3 SigmaAldrich Cat # 700194P Desmosterol-D6 SigmaAldrich Cat # 700040P Cholesterol-D7 SigmaAldrich Cat # 700041P 24(S),25-Epoxycholesterol Abcam Cat# ab141633 Deposited data RNA sequencing of PSC-derived neural cells This paper GEO: GSE119316 Experimental models: Cell lines H7 WiCell Cat# WA07; RRID:CVCL_9772 CYFIP1-GoF This paper N/A iCas9 Huangfu D laboratory, ref. 21 N/A CYFIP1-LoF This paper N/A LXRb KO This paper N/A 202 This paper N/A 900 This paper N/A EA8 This paper N/A EA62 This paper N/A Recombinant DNA CYFIP1 ORF OriGene Cat# SC100426 pCAG-IRES-PAC This paper N/A pCAG-CYFIP1-IRES-PAC This paper N/A pGEM-T Easy Promega Cat# A1360 Software and algorithms FlowJo_V10 www.flowjo.com RRID:SCR_008520 ImageJ NIH RRID:SCR_003070 CellProfiler www.cellprofiler.org RRID:SCR_007358 R packages www.r-pkgs.org/ RRID:SCR_003005 Bioconductor Packages www.bioconductor.org RRID:SCR_006442 TraceFinder 5.1 ThermoFisher Scientific RRID:SCR_023045

    Techniques: Labeling, Incubation, Cytometry, Cell Cycle Assay

    Figure 5. 24S,25-EC promotes neuronal differentiation of hESC-derived cortical NPCs (A) Bar graph showing the levels of 24S,25-EC produced by CYFIP1-GoF, CYFIP1-LoF, EA8, and EA62 15q11.2del iPSCs and respective control PSC-derived neural cells at d20, d30, and d40. n = 5 or 6 as indicated in Table S10. (B) Schematic illustration showing 24S,25-EC treatment time windows. (C) Representative images of immunostaining for TBR1, CTIP2, and NeuN at d25 H7 cultures treated with ethanol vehicle control and 24S,25-EC between d15 and d25. (D) Quantification of the immunocytochemical analysis represented in (C), n = 3. (E–G) Cumulative EdU incorporation assay of H7 cortical progenitor cultures treated with vehicle and increasing doses of 24S,25-EC from d15. Representative images of EdU+ cells (E). Length of S-phase (F) and total cell cycle (G) determined by Nowakowski equation for all conditions, n = 3.

    Journal: Cell reports

    Article Title: Impaired oxysterol-liver X receptor signaling underlies aberrant cortical neurogenesis in a stem cell model of neurodevelopmental disorder.

    doi: 10.1016/j.celrep.2024.113946

    Figure Lengend Snippet: Figure 5. 24S,25-EC promotes neuronal differentiation of hESC-derived cortical NPCs (A) Bar graph showing the levels of 24S,25-EC produced by CYFIP1-GoF, CYFIP1-LoF, EA8, and EA62 15q11.2del iPSCs and respective control PSC-derived neural cells at d20, d30, and d40. n = 5 or 6 as indicated in Table S10. (B) Schematic illustration showing 24S,25-EC treatment time windows. (C) Representative images of immunostaining for TBR1, CTIP2, and NeuN at d25 H7 cultures treated with ethanol vehicle control and 24S,25-EC between d15 and d25. (D) Quantification of the immunocytochemical analysis represented in (C), n = 3. (E–G) Cumulative EdU incorporation assay of H7 cortical progenitor cultures treated with vehicle and increasing doses of 24S,25-EC from d15. Representative images of EdU+ cells (E). Length of S-phase (F) and total cell cycle (G) determined by Nowakowski equation for all conditions, n = 3.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 24R/S-hydroxycholesterol-D6 SigmaAldrich Cat # 700018P 7a-hydroxycholesterol-D7 SigmaAldrich Cat # LM-4103 7-oxocholesterol-D7 SigmaAldrich Cat # LM-4107 22S-3O-hydroxycholesterol-D7 SigmaAldrich Cat # 700051P 7a, 25-dihydroxycholsterol-D6 SigmaAldrich Cat # 700078 3b-hydroxycholest-5-en-26-oic acid-D5 SigmaAldrich Cat # 700151P 7aH,3O-hydroxycholestenoic acid-D3 SigmaAldrich Cat # 700194P Desmosterol-D6 SigmaAldrich Cat # 700040P Cholesterol-D7 SigmaAldrich Cat # 700041P 24(S),25-Epoxycholesterol Abcam Cat# ab141633 Deposited data RNA sequencing of PSC-derived neural cells This paper GEO: GSE119316 Experimental models: Cell lines H7 WiCell Cat# WA07; RRID:CVCL_9772 CYFIP1-GoF This paper N/A iCas9 Huangfu D laboratory, ref. 21 N/A CYFIP1-LoF This paper N/A LXRb KO This paper N/A 202 This paper N/A 900 This paper N/A EA8 This paper N/A EA62 This paper N/A Recombinant DNA CYFIP1 ORF OriGene Cat# SC100426 pCAG-IRES-PAC This paper N/A pCAG-CYFIP1-IRES-PAC This paper N/A pGEM-T Easy Promega Cat# A1360 Software and algorithms FlowJo_V10 www.flowjo.com RRID:SCR_008520 ImageJ NIH RRID:SCR_003070 CellProfiler www.cellprofiler.org RRID:SCR_007358 R packages www.r-pkgs.org/ RRID:SCR_003005 Bioconductor Packages www.bioconductor.org RRID:SCR_006442 TraceFinder 5.1 ThermoFisher Scientific RRID:SCR_023045

    Techniques: Derivative Assay, Produced, Control, Immunostaining

    Figure 6. LXR signaling mediates oxysterol-regulated neurogenesis (A) Bar graph showing the number of differentially expressed LXRb and RXR target genes in CYFIP1-GoF, CYFIP1-LoF, and 15q11.2del NPCs and neurons. LXRb and RXR targets were compared to non-target DEGs by one-sided Fisher’s exact test (*p < 0.05; **p < 0.01; ***p < 0.001). (B and C) 24S,25-EC treatment during d15–d25 failed to promote neuronal production of LXRb-deficient NPCs.

    Journal: Cell reports

    Article Title: Impaired oxysterol-liver X receptor signaling underlies aberrant cortical neurogenesis in a stem cell model of neurodevelopmental disorder.

    doi: 10.1016/j.celrep.2024.113946

    Figure Lengend Snippet: Figure 6. LXR signaling mediates oxysterol-regulated neurogenesis (A) Bar graph showing the number of differentially expressed LXRb and RXR target genes in CYFIP1-GoF, CYFIP1-LoF, and 15q11.2del NPCs and neurons. LXRb and RXR targets were compared to non-target DEGs by one-sided Fisher’s exact test (*p < 0.05; **p < 0.01; ***p < 0.001). (B and C) 24S,25-EC treatment during d15–d25 failed to promote neuronal production of LXRb-deficient NPCs.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 24R/S-hydroxycholesterol-D6 SigmaAldrich Cat # 700018P 7a-hydroxycholesterol-D7 SigmaAldrich Cat # LM-4103 7-oxocholesterol-D7 SigmaAldrich Cat # LM-4107 22S-3O-hydroxycholesterol-D7 SigmaAldrich Cat # 700051P 7a, 25-dihydroxycholsterol-D6 SigmaAldrich Cat # 700078 3b-hydroxycholest-5-en-26-oic acid-D5 SigmaAldrich Cat # 700151P 7aH,3O-hydroxycholestenoic acid-D3 SigmaAldrich Cat # 700194P Desmosterol-D6 SigmaAldrich Cat # 700040P Cholesterol-D7 SigmaAldrich Cat # 700041P 24(S),25-Epoxycholesterol Abcam Cat# ab141633 Deposited data RNA sequencing of PSC-derived neural cells This paper GEO: GSE119316 Experimental models: Cell lines H7 WiCell Cat# WA07; RRID:CVCL_9772 CYFIP1-GoF This paper N/A iCas9 Huangfu D laboratory, ref. 21 N/A CYFIP1-LoF This paper N/A LXRb KO This paper N/A 202 This paper N/A 900 This paper N/A EA8 This paper N/A EA62 This paper N/A Recombinant DNA CYFIP1 ORF OriGene Cat# SC100426 pCAG-IRES-PAC This paper N/A pCAG-CYFIP1-IRES-PAC This paper N/A pGEM-T Easy Promega Cat# A1360 Software and algorithms FlowJo_V10 www.flowjo.com RRID:SCR_008520 ImageJ NIH RRID:SCR_003070 CellProfiler www.cellprofiler.org RRID:SCR_007358 R packages www.r-pkgs.org/ RRID:SCR_003005 Bioconductor Packages www.bioconductor.org RRID:SCR_006442 TraceFinder 5.1 ThermoFisher Scientific RRID:SCR_023045

    Techniques:

    A) Schematic representation of human CYFIP1 expression vector. B) qPCR quantification of CYFIP1 transcript levels in independent transgenic CYFIP1-GoF hESCs lines (TG#1 -10) and parental H7 cells (CTRL) at undifferentiated state. Data were normalised to the CTRL which was set as 1. C) qPCR analysis of CYFIP1 transcript during neuronal differentiation. Data shown are the mean between clones #3 and #5, all normalised to the CTRL cells at d5 of neuronal differentiation. D) Western blot confirming increased CYFIP1 protein level in CYFIP1-GoF cells (Clone #3) throughout 50 days of neuronal differentiation. Quantitative data on the right panel represent the average of clones #3 and #5. E) Schematic of CYFIP1 gene locus highlighting the first exon where gRNA sequences were designed. For space reasons, the sequence of the insertion present in one of the alleles of clone#70 is not reported and is indicated as “--200bp--”. F) DNA sequence flanking the edited site in the wild-type and edited CYFIP1 locus. G) Western blot demonstrating reduced CYFIP1 protein levels in 3 of the targeted clones (CYFIP1 clone#31, clone#41 and #70) compared to the parental line (CTRL).

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Schematic representation of human CYFIP1 expression vector. B) qPCR quantification of CYFIP1 transcript levels in independent transgenic CYFIP1-GoF hESCs lines (TG#1 -10) and parental H7 cells (CTRL) at undifferentiated state. Data were normalised to the CTRL which was set as 1. C) qPCR analysis of CYFIP1 transcript during neuronal differentiation. Data shown are the mean between clones #3 and #5, all normalised to the CTRL cells at d5 of neuronal differentiation. D) Western blot confirming increased CYFIP1 protein level in CYFIP1-GoF cells (Clone #3) throughout 50 days of neuronal differentiation. Quantitative data on the right panel represent the average of clones #3 and #5. E) Schematic of CYFIP1 gene locus highlighting the first exon where gRNA sequences were designed. For space reasons, the sequence of the insertion present in one of the alleles of clone#70 is not reported and is indicated as “--200bp--”. F) DNA sequence flanking the edited site in the wild-type and edited CYFIP1 locus. G) Western blot demonstrating reduced CYFIP1 protein levels in 3 of the targeted clones (CYFIP1 clone#31, clone#41 and #70) compared to the parental line (CTRL).

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Expressing, Plasmid Preparation, Transgenic Assay, Clone Assay, Western Blot, Sequencing

    A) Outline of the cortical differentiation paradigm. B) Immunostaining for PAX6 (red) and NeuN (green) for CYFIP1-GoF, CYFIP1-LoF and their respective isogenic controls at d35 of differentiation. C-D) Quantification of PAX6 + and NeuN + cells shown in B. E-F) Day 20-50 cortical cultures were immunostained for cortical neuronal markers TBR1 (red), CTIP2 (green) and SATB2 (red), shown are representative images of day 30 staining. G-H) Quantification of TBR1 + , CTIP2 + and SATB2 + of day 20 to day 50 cortical cultures, respectively. Data presented are mean±s.e.m. from at least three biological replicates, groups were compared by Student t-test between the CYFIP1-manipulated vs isogenic control at each time point (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Outline of the cortical differentiation paradigm. B) Immunostaining for PAX6 (red) and NeuN (green) for CYFIP1-GoF, CYFIP1-LoF and their respective isogenic controls at d35 of differentiation. C-D) Quantification of PAX6 + and NeuN + cells shown in B. E-F) Day 20-50 cortical cultures were immunostained for cortical neuronal markers TBR1 (red), CTIP2 (green) and SATB2 (red), shown are representative images of day 30 staining. G-H) Quantification of TBR1 + , CTIP2 + and SATB2 + of day 20 to day 50 cortical cultures, respectively. Data presented are mean±s.e.m. from at least three biological replicates, groups were compared by Student t-test between the CYFIP1-manipulated vs isogenic control at each time point (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Immunostaining, Staining, Control

    A-B) Immunostaining for PAX6 (red) and FOXG1 (green) in d15 CYFIP1-GoF and CYFIP1-LoF NPCs cultures and respective controls. C-D) Quantification of PAX6 + and FOXG1 + cells. Data represent mean±s.e.m. from three biological replicates and analysed by Student t-test. No significant differences were found. Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A-B) Immunostaining for PAX6 (red) and FOXG1 (green) in d15 CYFIP1-GoF and CYFIP1-LoF NPCs cultures and respective controls. C-D) Quantification of PAX6 + and FOXG1 + cells. Data represent mean±s.e.m. from three biological replicates and analysed by Student t-test. No significant differences were found. Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Immunostaining

    Immunostaining and quantification for the proliferation marker Ki67 (green) and the cell cycle regulator p27 kip (red) in CYFIP1-LoF and isogenic iCas9 control progenitor populations. Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm. Groups were compared by Student t-test (*p<0.05; **p<0.01).

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: Immunostaining and quantification for the proliferation marker Ki67 (green) and the cell cycle regulator p27 kip (red) in CYFIP1-LoF and isogenic iCas9 control progenitor populations. Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm. Groups were compared by Student t-test (*p<0.05; **p<0.01).

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Immunostaining, Marker, Control

    A) Schematic illustration of the RNAseq experimental flow. B-C) Bar graphs showing examples of DEGs related to neural progenitors and neuronal differentiation at NPC2 (B) and neuronal stage (C), respectively. Bar height represents fold change (FC) the shade of color represents the FDR adjusted p value. D-E) Gene ontologies (GO) enriched in the DEG datasets associated with CYFIP1-GoF (D) and CYFIP1-LoF (E), compared to the respective control samples for all developmental stages analysed. Bar height represents the -log10 of the Benjamini-Hochberg adjusted P value, red line shows the threshold of significance (i.e. padj < 0.05). F) Bar graphs showing DEGs involved in cholesterol biosynthesis (green) and metabolism (red) and the master transcription factors for fatty acid and cholesterol biosynthesis (blue) at NPC2 and neuronal stages.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Schematic illustration of the RNAseq experimental flow. B-C) Bar graphs showing examples of DEGs related to neural progenitors and neuronal differentiation at NPC2 (B) and neuronal stage (C), respectively. Bar height represents fold change (FC) the shade of color represents the FDR adjusted p value. D-E) Gene ontologies (GO) enriched in the DEG datasets associated with CYFIP1-GoF (D) and CYFIP1-LoF (E), compared to the respective control samples for all developmental stages analysed. Bar height represents the -log10 of the Benjamini-Hochberg adjusted P value, red line shows the threshold of significance (i.e. padj < 0.05). F) Bar graphs showing DEGs involved in cholesterol biosynthesis (green) and metabolism (red) and the master transcription factors for fatty acid and cholesterol biosynthesis (blue) at NPC2 and neuronal stages.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Control

    A-B) PCA plot of CYFIP1-LoF, CYFIP1-GoF and their respective isogenic control cultures at d10 (NPC1), d20 (NPC2) and d40 (Neurons). C-D) Western blots analysis for CYFIP1, NIPA2, TUBGCP5 and GAPDH (internal control) on neural cells derived from control (CTRL) and 15q11.2-deleted iPSCs (EA8 and EA62), at the NPCs and neuronal stage. The quantitative protein level is expressed as intensity of the band corresponding to the protein of interest, normalised to the intensity of the GAPDH band on the same gel. Groups were compared by one-way ANOVA, followed by Tukey post-hoc test (*p<0.05). E) PCA for NPCs and neurons derived from 15q11.2del iPSC (EA8 and EA62) and two control iPSC lines. PC1 captures the largest difference segregating the different developmental stages while PC2 captures differences between genetic backgrounds. C) Bar graphs showing relative levels of 15q11.2 CNV transcripts to respective control cells at each of differentiation stage analysed. Bar height represents fold change (FC)

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A-B) PCA plot of CYFIP1-LoF, CYFIP1-GoF and their respective isogenic control cultures at d10 (NPC1), d20 (NPC2) and d40 (Neurons). C-D) Western blots analysis for CYFIP1, NIPA2, TUBGCP5 and GAPDH (internal control) on neural cells derived from control (CTRL) and 15q11.2-deleted iPSCs (EA8 and EA62), at the NPCs and neuronal stage. The quantitative protein level is expressed as intensity of the band corresponding to the protein of interest, normalised to the intensity of the GAPDH band on the same gel. Groups were compared by one-way ANOVA, followed by Tukey post-hoc test (*p<0.05). E) PCA for NPCs and neurons derived from 15q11.2del iPSC (EA8 and EA62) and two control iPSC lines. PC1 captures the largest difference segregating the different developmental stages while PC2 captures differences between genetic backgrounds. C) Bar graphs showing relative levels of 15q11.2 CNV transcripts to respective control cells at each of differentiation stage analysed. Bar height represents fold change (FC)

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Control, Western Blot, Derivative Assay

    A) Bar graph showing the levels of 24S,25-EC produced by CYFIP1-GoF, CYFIP1-LoF, EA8 and EA62 15q11.2del iPSC and respective control PSC-derived neural cells at d20, 30 and 40. B) Schematic illustration showing 24S,25-EC treatment time windows. C) Representative images of immunostaining for TBR1, CTIP2 and NeuN at day 25 H7 cultures treated with ethanol vehicle control, and 24S,25-EC between day15-25. D) Quantification of the immunocytochemical analysis represented in C. E-G) Cumulative EdU incorporation assay of H7 cortical progenitor cultures treated with vehicle and increasing doses with 24S,25-EC from d15. Length of S-phase (F) and total cell cycle (G) determined by Nowakowski equation for all conditions. H) Quantification of TBR1 + , CTIP2 + and NeuN + in d25 CYFIP1-GoF cultures after 10 days exposure to increasing dose of 24S,25-EC or ethanol control. The red dashed line indicates the baseline (untreated) level in the isogenic control line. Data shown are mean±s.e.m. from three biological replicates per measurement (A) or treatment (D, F-H). Groups were compared by Student t-test between the indicated genotype and respective control per time point in A and one-way ANOVA followed by Tukey correction for D, F-H (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Bar graph showing the levels of 24S,25-EC produced by CYFIP1-GoF, CYFIP1-LoF, EA8 and EA62 15q11.2del iPSC and respective control PSC-derived neural cells at d20, 30 and 40. B) Schematic illustration showing 24S,25-EC treatment time windows. C) Representative images of immunostaining for TBR1, CTIP2 and NeuN at day 25 H7 cultures treated with ethanol vehicle control, and 24S,25-EC between day15-25. D) Quantification of the immunocytochemical analysis represented in C. E-G) Cumulative EdU incorporation assay of H7 cortical progenitor cultures treated with vehicle and increasing doses with 24S,25-EC from d15. Length of S-phase (F) and total cell cycle (G) determined by Nowakowski equation for all conditions. H) Quantification of TBR1 + , CTIP2 + and NeuN + in d25 CYFIP1-GoF cultures after 10 days exposure to increasing dose of 24S,25-EC or ethanol control. The red dashed line indicates the baseline (untreated) level in the isogenic control line. Data shown are mean±s.e.m. from three biological replicates per measurement (A) or treatment (D, F-H). Groups were compared by Student t-test between the indicated genotype and respective control per time point in A and one-way ANOVA followed by Tukey correction for D, F-H (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Produced, Control, Derivative Assay, Immunostaining

    A-B) Illustration of experimental scheme, immunocytochemistry and quantification for TBR1, CTIP2 and NeuN in d30 H7 cultures treated with 24S,25-EC from d20. C-D) Illustration of 24S,25-EC treatment scheme for iCas9 iPSC line, immunostaining and quantification for TBR1, CTIP2 and NeuN in d25 iCas9 cultures. E) immunocytochemistry for Ki67 4 days after 24S,25-EC or ethanol exposure. F) Number of Ki67 + and phosphorylated histone H3 + (pH3 + ) cells in H7 cultures treated with or without increasing dose of 24S,25-EC for 4 days from d15. G) Quantification of TBR1 + , CTIP2 + and NeuN + in d25 CYFIP1-GoF and H7 control cultures after 10 days exposure to increasing dose of 24S,25-EC or ethanol control. Data shown are mean±s.e.m. from three biological replicates. Shown in ‘G’ are the same data of presented as fold change of 24S,25-EC treated cultures to none treated cultures of CYFIP1-GoF (light blue) and isogenic H7 control (dark blue), respectively. Groups were compared by one-way ANOVA followed by Tukey correction (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A-B) Illustration of experimental scheme, immunocytochemistry and quantification for TBR1, CTIP2 and NeuN in d30 H7 cultures treated with 24S,25-EC from d20. C-D) Illustration of 24S,25-EC treatment scheme for iCas9 iPSC line, immunostaining and quantification for TBR1, CTIP2 and NeuN in d25 iCas9 cultures. E) immunocytochemistry for Ki67 4 days after 24S,25-EC or ethanol exposure. F) Number of Ki67 + and phosphorylated histone H3 + (pH3 + ) cells in H7 cultures treated with or without increasing dose of 24S,25-EC for 4 days from d15. G) Quantification of TBR1 + , CTIP2 + and NeuN + in d25 CYFIP1-GoF and H7 control cultures after 10 days exposure to increasing dose of 24S,25-EC or ethanol control. Data shown are mean±s.e.m. from three biological replicates. Shown in ‘G’ are the same data of presented as fold change of 24S,25-EC treated cultures to none treated cultures of CYFIP1-GoF (light blue) and isogenic H7 control (dark blue), respectively. Groups were compared by one-way ANOVA followed by Tukey correction (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Immunocytochemistry, Immunostaining, Control

    A) Bar graph showing the number of differentially expressed LXRβ and RXR target genes in CYFIP1-GoF, CYFIP1-LoF and 15q11.2del NPCs and neurons. LXRβ and RXR targets were compared to non-target DEGs by one-sided Fisher’s exact test (*p<0.05; **p<0.01; ***p<0.001). B-C) 24S,25-EC treatment during d15-25 failed to promote neuronal production of LXRβ-deficient NPCs. D-E) Premature neuronal differentiation of CYFIP1-LoF NPC is reversed by compound deletion of LXRβ and CYFIP1. Data shown in C and E are mean±s.e.m. from three biological replicates per treatment (C) or genotype (E). Groups were compared by one-way ANOVA followed by Tukey correction (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Bar graph showing the number of differentially expressed LXRβ and RXR target genes in CYFIP1-GoF, CYFIP1-LoF and 15q11.2del NPCs and neurons. LXRβ and RXR targets were compared to non-target DEGs by one-sided Fisher’s exact test (*p<0.05; **p<0.01; ***p<0.001). B-C) 24S,25-EC treatment during d15-25 failed to promote neuronal production of LXRβ-deficient NPCs. D-E) Premature neuronal differentiation of CYFIP1-LoF NPC is reversed by compound deletion of LXRβ and CYFIP1. Data shown in C and E are mean±s.e.m. from three biological replicates per treatment (C) or genotype (E). Groups were compared by one-way ANOVA followed by Tukey correction (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques:

    A) Schematic of LXRβ gene locus highlighting exon 4 where gRNA sequences were designed. B) Detection of InDels (insertions and deletions) via Sanger sequencing of the targeted exon 4 in iCas9 and CYFIP1-LoF background, respectively. C) Western blot analysis for LXRβ protein in iCas9 isogenic control, CYFIP1-LoF, LXRβ knockout and CYFIP1 & LXRβ double knockout iPSCs.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Schematic of LXRβ gene locus highlighting exon 4 where gRNA sequences were designed. B) Detection of InDels (insertions and deletions) via Sanger sequencing of the targeted exon 4 in iCas9 and CYFIP1-LoF background, respectively. C) Western blot analysis for LXRβ protein in iCas9 isogenic control, CYFIP1-LoF, LXRβ knockout and CYFIP1 & LXRβ double knockout iPSCs.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Sequencing, Western Blot, Control, Knock-Out, Double Knockout

    A) Schematic representation of human CYFIP1 expression vector. B) qPCR quantification of CYFIP1 transcript levels in independent transgenic CYFIP1-GoF hESCs lines (TG#1 -10) and parental H7 cells (CTRL) at undifferentiated state. Data were normalised to the CTRL which was set as 1. C) qPCR analysis of CYFIP1 transcript during neuronal differentiation. Data shown are the mean between clones #3 and #5, all normalised to the CTRL cells at d5 of neuronal differentiation. D) Western blot confirming increased CYFIP1 protein level in CYFIP1-GoF cells (Clone #3) throughout 50 days of neuronal differentiation. Quantitative data on the right panel represent the average of clones #3 and #5. E) Schematic of CYFIP1 gene locus highlighting the first exon where gRNA sequences were designed. For space reasons, the sequence of the insertion present in one of the alleles of clone#70 is not reported and is indicated as “--200bp--”. F) DNA sequence flanking the edited site in the wild-type and edited CYFIP1 locus. G) Western blot demonstrating reduced CYFIP1 protein levels in 3 of the targeted clones (CYFIP1 clone#31, clone#41 and #70) compared to the parental line (CTRL).

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Schematic representation of human CYFIP1 expression vector. B) qPCR quantification of CYFIP1 transcript levels in independent transgenic CYFIP1-GoF hESCs lines (TG#1 -10) and parental H7 cells (CTRL) at undifferentiated state. Data were normalised to the CTRL which was set as 1. C) qPCR analysis of CYFIP1 transcript during neuronal differentiation. Data shown are the mean between clones #3 and #5, all normalised to the CTRL cells at d5 of neuronal differentiation. D) Western blot confirming increased CYFIP1 protein level in CYFIP1-GoF cells (Clone #3) throughout 50 days of neuronal differentiation. Quantitative data on the right panel represent the average of clones #3 and #5. E) Schematic of CYFIP1 gene locus highlighting the first exon where gRNA sequences were designed. For space reasons, the sequence of the insertion present in one of the alleles of clone#70 is not reported and is indicated as “--200bp--”. F) DNA sequence flanking the edited site in the wild-type and edited CYFIP1 locus. G) Western blot demonstrating reduced CYFIP1 protein levels in 3 of the targeted clones (CYFIP1 clone#31, clone#41 and #70) compared to the parental line (CTRL).

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Expressing, Plasmid Preparation, Transgenic Assay, Clone Assay, Western Blot, Sequencing

    A) Outline of the cortical differentiation paradigm. B) Immunostaining for PAX6 (red) and NeuN (green) for CYFIP1-GoF, CYFIP1-LoF and their respective isogenic controls at d35 of differentiation. C-D) Quantification of PAX6 + and NeuN + cells shown in B. E-F) Day 20-50 cortical cultures were immunostained for cortical neuronal markers TBR1 (red), CTIP2 (green) and SATB2 (red), shown are representative images of day 30 staining. G-H) Quantification of TBR1 + , CTIP2 + and SATB2 + of day 20 to day 50 cortical cultures, respectively. Data presented are mean±s.e.m. from at least three biological replicates, groups were compared by Student t-test between the CYFIP1-manipulated vs isogenic control at each time point (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Outline of the cortical differentiation paradigm. B) Immunostaining for PAX6 (red) and NeuN (green) for CYFIP1-GoF, CYFIP1-LoF and their respective isogenic controls at d35 of differentiation. C-D) Quantification of PAX6 + and NeuN + cells shown in B. E-F) Day 20-50 cortical cultures were immunostained for cortical neuronal markers TBR1 (red), CTIP2 (green) and SATB2 (red), shown are representative images of day 30 staining. G-H) Quantification of TBR1 + , CTIP2 + and SATB2 + of day 20 to day 50 cortical cultures, respectively. Data presented are mean±s.e.m. from at least three biological replicates, groups were compared by Student t-test between the CYFIP1-manipulated vs isogenic control at each time point (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Immunostaining, Staining, Control

    A-B) Immunostaining for PAX6 (red) and FOXG1 (green) in d15 CYFIP1-GoF and CYFIP1-LoF NPCs cultures and respective controls. C-D) Quantification of PAX6 + and FOXG1 + cells. Data represent mean±s.e.m. from three biological replicates and analysed by Student t-test. No significant differences were found. Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A-B) Immunostaining for PAX6 (red) and FOXG1 (green) in d15 CYFIP1-GoF and CYFIP1-LoF NPCs cultures and respective controls. C-D) Quantification of PAX6 + and FOXG1 + cells. Data represent mean±s.e.m. from three biological replicates and analysed by Student t-test. No significant differences were found. Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Immunostaining

    Immunostaining and quantification for the proliferation marker Ki67 (green) and the cell cycle regulator p27 kip (red) in CYFIP1-LoF and isogenic iCas9 control progenitor populations. Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm. Groups were compared by Student t-test (*p<0.05; **p<0.01).

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: Immunostaining and quantification for the proliferation marker Ki67 (green) and the cell cycle regulator p27 kip (red) in CYFIP1-LoF and isogenic iCas9 control progenitor populations. Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm. Groups were compared by Student t-test (*p<0.05; **p<0.01).

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Immunostaining, Marker, Control

    A) Schematic illustration of the RNAseq experimental flow. B-C) Bar graphs showing examples of DEGs related to neural progenitors and neuronal differentiation at NPC2 (B) and neuronal stage (C), respectively. Bar height represents fold change (FC) the shade of color represents the FDR adjusted p value. D-E) Gene ontologies (GO) enriched in the DEG datasets associated with CYFIP1-GoF (D) and CYFIP1-LoF (E), compared to the respective control samples for all developmental stages analysed. Bar height represents the -log10 of the Benjamini-Hochberg adjusted P value, red line shows the threshold of significance (i.e. padj < 0.05). F) Bar graphs showing DEGs involved in cholesterol biosynthesis (green) and metabolism (red) and the master transcription factors for fatty acid and cholesterol biosynthesis (blue) at NPC2 and neuronal stages.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Schematic illustration of the RNAseq experimental flow. B-C) Bar graphs showing examples of DEGs related to neural progenitors and neuronal differentiation at NPC2 (B) and neuronal stage (C), respectively. Bar height represents fold change (FC) the shade of color represents the FDR adjusted p value. D-E) Gene ontologies (GO) enriched in the DEG datasets associated with CYFIP1-GoF (D) and CYFIP1-LoF (E), compared to the respective control samples for all developmental stages analysed. Bar height represents the -log10 of the Benjamini-Hochberg adjusted P value, red line shows the threshold of significance (i.e. padj < 0.05). F) Bar graphs showing DEGs involved in cholesterol biosynthesis (green) and metabolism (red) and the master transcription factors for fatty acid and cholesterol biosynthesis (blue) at NPC2 and neuronal stages.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Control

    A-B) PCA plot of CYFIP1-LoF, CYFIP1-GoF and their respective isogenic control cultures at d10 (NPC1), d20 (NPC2) and d40 (Neurons). C-D) Western blots analysis for CYFIP1, NIPA2, TUBGCP5 and GAPDH (internal control) on neural cells derived from control (CTRL) and 15q11.2-deleted iPSCs (EA8 and EA62), at the NPCs and neuronal stage. The quantitative protein level is expressed as intensity of the band corresponding to the protein of interest, normalised to the intensity of the GAPDH band on the same gel. Groups were compared by one-way ANOVA, followed by Tukey post-hoc test (*p<0.05). E) PCA for NPCs and neurons derived from 15q11.2del iPSC (EA8 and EA62) and two control iPSC lines. PC1 captures the largest difference segregating the different developmental stages while PC2 captures differences between genetic backgrounds. C) Bar graphs showing relative levels of 15q11.2 CNV transcripts to respective control cells at each of differentiation stage analysed. Bar height represents fold change (FC)

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A-B) PCA plot of CYFIP1-LoF, CYFIP1-GoF and their respective isogenic control cultures at d10 (NPC1), d20 (NPC2) and d40 (Neurons). C-D) Western blots analysis for CYFIP1, NIPA2, TUBGCP5 and GAPDH (internal control) on neural cells derived from control (CTRL) and 15q11.2-deleted iPSCs (EA8 and EA62), at the NPCs and neuronal stage. The quantitative protein level is expressed as intensity of the band corresponding to the protein of interest, normalised to the intensity of the GAPDH band on the same gel. Groups were compared by one-way ANOVA, followed by Tukey post-hoc test (*p<0.05). E) PCA for NPCs and neurons derived from 15q11.2del iPSC (EA8 and EA62) and two control iPSC lines. PC1 captures the largest difference segregating the different developmental stages while PC2 captures differences between genetic backgrounds. C) Bar graphs showing relative levels of 15q11.2 CNV transcripts to respective control cells at each of differentiation stage analysed. Bar height represents fold change (FC)

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Control, Western Blot, Derivative Assay

    A) Bar graph showing the levels of 24S,25-EC produced by CYFIP1-GoF, CYFIP1-LoF, EA8 and EA62 15q11.2del iPSC and respective control PSC-derived neural cells at d20, 30 and 40. B) Schematic illustration showing 24S,25-EC treatment time windows. C) Representative images of immunostaining for TBR1, CTIP2 and NeuN at day 25 H7 cultures treated with ethanol vehicle control, and 24S,25-EC between day15-25. D) Quantification of the immunocytochemical analysis represented in C. E-G) Cumulative EdU incorporation assay of H7 cortical progenitor cultures treated with vehicle and increasing doses with 24S,25-EC from d15. Length of S-phase (F) and total cell cycle (G) determined by Nowakowski equation for all conditions. H) Quantification of TBR1 + , CTIP2 + and NeuN + in d25 CYFIP1-GoF cultures after 10 days exposure to increasing dose of 24S,25-EC or ethanol control. The red dashed line indicates the baseline (untreated) level in the isogenic control line. Data shown are mean±s.e.m. from three biological replicates per measurement (A) or treatment (D, F-H). Groups were compared by Student t-test between the indicated genotype and respective control per time point in A and one-way ANOVA followed by Tukey correction for D, F-H (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Bar graph showing the levels of 24S,25-EC produced by CYFIP1-GoF, CYFIP1-LoF, EA8 and EA62 15q11.2del iPSC and respective control PSC-derived neural cells at d20, 30 and 40. B) Schematic illustration showing 24S,25-EC treatment time windows. C) Representative images of immunostaining for TBR1, CTIP2 and NeuN at day 25 H7 cultures treated with ethanol vehicle control, and 24S,25-EC between day15-25. D) Quantification of the immunocytochemical analysis represented in C. E-G) Cumulative EdU incorporation assay of H7 cortical progenitor cultures treated with vehicle and increasing doses with 24S,25-EC from d15. Length of S-phase (F) and total cell cycle (G) determined by Nowakowski equation for all conditions. H) Quantification of TBR1 + , CTIP2 + and NeuN + in d25 CYFIP1-GoF cultures after 10 days exposure to increasing dose of 24S,25-EC or ethanol control. The red dashed line indicates the baseline (untreated) level in the isogenic control line. Data shown are mean±s.e.m. from three biological replicates per measurement (A) or treatment (D, F-H). Groups were compared by Student t-test between the indicated genotype and respective control per time point in A and one-way ANOVA followed by Tukey correction for D, F-H (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Produced, Control, Derivative Assay, Immunostaining

    A-B) Illustration of experimental scheme, immunocytochemistry and quantification for TBR1, CTIP2 and NeuN in d30 H7 cultures treated with 24S,25-EC from d20. C-D) Illustration of 24S,25-EC treatment scheme for iCas9 iPSC line, immunostaining and quantification for TBR1, CTIP2 and NeuN in d25 iCas9 cultures. E) immunocytochemistry for Ki67 4 days after 24S,25-EC or ethanol exposure. F) Number of Ki67 + and phosphorylated histone H3 + (pH3 + ) cells in H7 cultures treated with or without increasing dose of 24S,25-EC for 4 days from d15. G) Quantification of TBR1 + , CTIP2 + and NeuN + in d25 CYFIP1-GoF and H7 control cultures after 10 days exposure to increasing dose of 24S,25-EC or ethanol control. Data shown are mean±s.e.m. from three biological replicates. Shown in ‘G’ are the same data of presented as fold change of 24S,25-EC treated cultures to none treated cultures of CYFIP1-GoF (light blue) and isogenic H7 control (dark blue), respectively. Groups were compared by one-way ANOVA followed by Tukey correction (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A-B) Illustration of experimental scheme, immunocytochemistry and quantification for TBR1, CTIP2 and NeuN in d30 H7 cultures treated with 24S,25-EC from d20. C-D) Illustration of 24S,25-EC treatment scheme for iCas9 iPSC line, immunostaining and quantification for TBR1, CTIP2 and NeuN in d25 iCas9 cultures. E) immunocytochemistry for Ki67 4 days after 24S,25-EC or ethanol exposure. F) Number of Ki67 + and phosphorylated histone H3 + (pH3 + ) cells in H7 cultures treated with or without increasing dose of 24S,25-EC for 4 days from d15. G) Quantification of TBR1 + , CTIP2 + and NeuN + in d25 CYFIP1-GoF and H7 control cultures after 10 days exposure to increasing dose of 24S,25-EC or ethanol control. Data shown are mean±s.e.m. from three biological replicates. Shown in ‘G’ are the same data of presented as fold change of 24S,25-EC treated cultures to none treated cultures of CYFIP1-GoF (light blue) and isogenic H7 control (dark blue), respectively. Groups were compared by one-way ANOVA followed by Tukey correction (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Immunocytochemistry, Immunostaining, Control

    A) Bar graph showing the number of differentially expressed LXRβ and RXR target genes in CYFIP1-GoF, CYFIP1-LoF and 15q11.2del NPCs and neurons. LXRβ and RXR targets were compared to non-target DEGs by one-sided Fisher’s exact test (*p<0.05; **p<0.01; ***p<0.001). B-C) 24S,25-EC treatment during d15-25 failed to promote neuronal production of LXRβ-deficient NPCs. D-E) Premature neuronal differentiation of CYFIP1-LoF NPC is reversed by compound deletion of LXRβ and CYFIP1. Data shown in C and E are mean±s.e.m. from three biological replicates per treatment (C) or genotype (E). Groups were compared by one-way ANOVA followed by Tukey correction (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Bar graph showing the number of differentially expressed LXRβ and RXR target genes in CYFIP1-GoF, CYFIP1-LoF and 15q11.2del NPCs and neurons. LXRβ and RXR targets were compared to non-target DEGs by one-sided Fisher’s exact test (*p<0.05; **p<0.01; ***p<0.001). B-C) 24S,25-EC treatment during d15-25 failed to promote neuronal production of LXRβ-deficient NPCs. D-E) Premature neuronal differentiation of CYFIP1-LoF NPC is reversed by compound deletion of LXRβ and CYFIP1. Data shown in C and E are mean±s.e.m. from three biological replicates per treatment (C) or genotype (E). Groups were compared by one-way ANOVA followed by Tukey correction (*p<0.05; **p<0.01; ***p<0.001). Nuclei were counterstained with DAPI (blue). Scale bars: 50 µm.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques:

    A) Schematic of LXRβ gene locus highlighting exon 4 where gRNA sequences were designed. B) Detection of InDels (insertions and deletions) via Sanger sequencing of the targeted exon 4 in iCas9 and CYFIP1-LoF background, respectively. C) Western blot analysis for LXRβ protein in iCas9 isogenic control, CYFIP1-LoF, LXRβ knockout and CYFIP1 & LXRβ double knockout iPSCs.

    Journal: bioRxiv

    Article Title: Oxysterol-liver X receptor signaling mediates CYFIP1 regulation of cortical neurogenesis

    doi: 10.1101/2023.06.23.546272

    Figure Lengend Snippet: A) Schematic of LXRβ gene locus highlighting exon 4 where gRNA sequences were designed. B) Detection of InDels (insertions and deletions) via Sanger sequencing of the targeted exon 4 in iCas9 and CYFIP1-LoF background, respectively. C) Western blot analysis for LXRβ protein in iCas9 isogenic control, CYFIP1-LoF, LXRβ knockout and CYFIP1 & LXRβ double knockout iPSCs.

    Article Snippet: For CYFIP1 overexpression (CYFIP1-GoF), human CYFIP1 open reading frame (SC100426, OriGene) was cloned into a pCAG-IRES-PAC plasmid upstream of the IRES sequence [1].

    Techniques: Sequencing, Western Blot, Control, Knock-Out, Double Knockout